escherichia coli (migula) castellani and chalmers (ATCC)
ATCC is a verified supplier 
ATCC manufactures this product 
99
Structured Review
ATCC
escherichia coli (migula) castellani and chalmers
Escherichia Coli (Migula) Castellani And Chalmers, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 2224 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/escherichia+coli+c/Escherichia+coli+(Migula)+Castellani+and+Chalmers/custom%4011229%4042503596
Average 99 stars, based on 2224 article reviews
Escherichia Coli (Migula) Castellani And Chalmers, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 2224 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/escherichia+coli+c/Escherichia+coli+(Migula)+Castellani+and+Chalmers/custom%4011229%4042503596
Average 99 stars, based on 2224 article reviews
escherichia coli (migula) castellani and chalmers - by Bioz Stars,
2026-09
99/100 stars
Images
Related Articles
other:Article Title: Biological Investigation of 2-Thioxo-benzo[g]quinazolines against Adenovirus Type 7 and Bacteriophage Phi X174: An In Vitro Study. Article Snippet: Article Title: Escherichia coli aceE variants coding pyruvate dehydrogenase improve the generation of pyruvate‐derived acetoin Article Snippet: Cell Culture:Article Title: Differential translocation of bacteriophages across the intestinal barrier in health and Crohn’s disease Article Snippet: .. The bacterial strains used in this study, Escherichia coli K-12 MG1655 F+ , Escherichia coli K-12 MG1655 , and Article Title: Differential translocation of bacteriophages across the intestinal barrier in health and Crohn's disease. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Pierce TM high-capacity endotoxin removal resin Thermo Fisher Scientific Cat#: 88270 Power SYBR TM Green PCR Master Mix Applied Biosystems, Fisher Scientific Cat#: 10658255 ProLong TM Gold Antifade Mountant Invitrogen, Thermo Fisher Scientific Cat#: P36934 Proteinase K Thermo Fisher Scientific Cat#: EO0491 Recombinant human interferon-γ (IFNγ) Bio-Techne Cat#: 285-IF/CF Recombinant human tumor necrosis factor-α (TNFα) Bio-Techne Cat#: 210-TA/CF RNA later Sigma-Aldrich Cat#: R0901 RNase I (10 U/μL) Thermo Scientific Cat#: EN0601 Triton X-100 Sigma-Aldrich Cat#: T9284 Critical commercial assays Cytotoxicity Detection KitPLUS (LDH) Roche Cat#: 04744926001 Duoset human IL-8 ELISA kit R&D Systems Cat#: DY208 EndoTrap® HD kit Lionex Cat#: LET0010 Pierce TM Chromogenic Endotoxin Quant kit Thermo Fisher Scientific Cat#: A39552S xGen TM DNA Library Preparation kit Integrated DNA Technologies Cat#: 10009821 Deposited data Metagenomic data ENA PRJNA1126425 vOTU annotation entrepot.recherche.data.gouv.fr https://doi.org/10.57745/FTIXS5 Experimental models: Cell lines Caco-2/TC7 human colon adenocarcinoma cell line stock laboratory Chantret et al. 40 HUVEC primary endothelial cells Lonza Cat#: C2519A HUVEC primary endothelial cells Stock laboratory prepared from umbilical cords donated by Bluets Maternity Hospital (Paris) MTA Sorbonne Université C22/1604 Experimental models: Organisms/strains Mouse: C57BL/6J Charles River Cat#: 000664, RRID: IMSR_JAX:000664 Oligonucleotides M13 phage; Forward CACCGTTCATCTGTCCTCTTT; Reverse CGACCTGCTCCATGTTACTTAG Eurogentec N/A T4 phage; Forward ACTGGCCAGGTATTCGCA; Reverse ATGCTTCTTTAGCAGCGGCA Eurogentec N/A ΦX174 phage; Forward GGTTCGTCAAGGACTGGTT; Reverse TTGAACAGCATCGGACTCAG Eurogentec N/A Software and algorithms bbmap 38.86 Bushnell 75 https://github.com/BioInfoTools/BBMap Biorender Biorender https://www.biorender.com/ BLAT 36 Kent 76 https://github.com/djhshih/blat Bowtie2 2.4.1 Langmead and Salzberg 77 https://github.com/BenLangmead/bowtie2 bwa-mem2 2.2.1 Vasimuddin et al. 78 https://github.com/bwa-mem2/bwa-mem2 CheckV 0.8.1 Nayfach et al. 79 https://bitbucket.org/berkeleylab/checkv fastp 0.23.1 Chen et al. 80 https://github.com/OpenGene/fastp graphanalyzer 1.5.1 Pandolfo et al. 81 https://github.com/lazzarigioele/graphanalyzer GraphPad Prism GraphPad Software https://www.graphpad.com/ ImageJ Fiji NIH https://imagej.nih.gov/ij/ iPHoP 1.2.0 Roux et al. 82 https://bitbucket.org/srouxjgi/iphop (Continued on next page) 18 Cell Reports 45, 116726, January 27, 2026 .. The bacterial strains used in this study, Escherichia coli K-12 MG1655 F+, 74 Escherichia coli K-12 MG1655, 89 and Plaque Assay:Article Title: Differential translocation of bacteriophages across the intestinal barrier in health and Crohn’s disease Article Snippet: .. The bacterial strains used in this study, Escherichia coli K-12 MG1655 F+ , Escherichia coli K-12 MG1655 , and Article Title: Differential translocation of bacteriophages across the intestinal barrier in health and Crohn's disease. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Pierce TM high-capacity endotoxin removal resin Thermo Fisher Scientific Cat#: 88270 Power SYBR TM Green PCR Master Mix Applied Biosystems, Fisher Scientific Cat#: 10658255 ProLong TM Gold Antifade Mountant Invitrogen, Thermo Fisher Scientific Cat#: P36934 Proteinase K Thermo Fisher Scientific Cat#: EO0491 Recombinant human interferon-γ (IFNγ) Bio-Techne Cat#: 285-IF/CF Recombinant human tumor necrosis factor-α (TNFα) Bio-Techne Cat#: 210-TA/CF RNA later Sigma-Aldrich Cat#: R0901 RNase I (10 U/μL) Thermo Scientific Cat#: EN0601 Triton X-100 Sigma-Aldrich Cat#: T9284 Critical commercial assays Cytotoxicity Detection KitPLUS (LDH) Roche Cat#: 04744926001 Duoset human IL-8 ELISA kit R&D Systems Cat#: DY208 EndoTrap® HD kit Lionex Cat#: LET0010 Pierce TM Chromogenic Endotoxin Quant kit Thermo Fisher Scientific Cat#: A39552S xGen TM DNA Library Preparation kit Integrated DNA Technologies Cat#: 10009821 Deposited data Metagenomic data ENA PRJNA1126425 vOTU annotation entrepot.recherche.data.gouv.fr https://doi.org/10.57745/FTIXS5 Experimental models: Cell lines Caco-2/TC7 human colon adenocarcinoma cell line stock laboratory Chantret et al. 40 HUVEC primary endothelial cells Lonza Cat#: C2519A HUVEC primary endothelial cells Stock laboratory prepared from umbilical cords donated by Bluets Maternity Hospital (Paris) MTA Sorbonne Université C22/1604 Experimental models: Organisms/strains Mouse: C57BL/6J Charles River Cat#: 000664, RRID: IMSR_JAX:000664 Oligonucleotides M13 phage; Forward CACCGTTCATCTGTCCTCTTT; Reverse CGACCTGCTCCATGTTACTTAG Eurogentec N/A T4 phage; Forward ACTGGCCAGGTATTCGCA; Reverse ATGCTTCTTTAGCAGCGGCA Eurogentec N/A ΦX174 phage; Forward GGTTCGTCAAGGACTGGTT; Reverse TTGAACAGCATCGGACTCAG Eurogentec N/A Software and algorithms bbmap 38.86 Bushnell 75 https://github.com/BioInfoTools/BBMap Biorender Biorender https://www.biorender.com/ BLAT 36 Kent 76 https://github.com/djhshih/blat Bowtie2 2.4.1 Langmead and Salzberg 77 https://github.com/BenLangmead/bowtie2 bwa-mem2 2.2.1 Vasimuddin et al. 78 https://github.com/bwa-mem2/bwa-mem2 CheckV 0.8.1 Nayfach et al. 79 https://bitbucket.org/berkeleylab/checkv fastp 0.23.1 Chen et al. 80 https://github.com/OpenGene/fastp graphanalyzer 1.5.1 Pandolfo et al. 81 https://github.com/lazzarigioele/graphanalyzer GraphPad Prism GraphPad Software https://www.graphpad.com/ ImageJ Fiji NIH https://imagej.nih.gov/ij/ iPHoP 1.2.0 Roux et al. 82 https://bitbucket.org/srouxjgi/iphop (Continued on next page) 18 Cell Reports 45, 116726, January 27, 2026 .. The bacterial strains used in this study, Escherichia coli K-12 MG1655 F+, 74 Escherichia coli K-12 MG1655, 89 and |